LeetCode187——Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

实现：

class Solution {

public:

vector<string> findRepeatedDnaSequences(string s) {

vector<string> vs;

char hash[1048575] = {0};

if (s.size() < 11) return vs;

int len = s.size();

int flag = 0;

for (int i = 0; i < 9; i++) {

flag = flag << 2 | (s[i] - 'A' + 1) % 5;

}

for (int i = 9; i < s.size(); i++) {

if (hash[(flag= flag << 2 | (s[i] - 'A' + 1) % 5)&0xfffff]++ == 1) {

vs.push_back(s.substr(i-9, 10));

}

}

return vs;

}

};